27. These substitutions are performed such that each successive codon identifier (three nucleotide sequence) is added to the 3' end of the nucleic acid sequence. This strain is referred to as M. mycoides JCVI- synl . The new cells have the phenotypic properties expected for M. mycoides and the designed synthetic DNA sequence, including watermark sequences and other designed gene deletions and polymorphisms. ), one or more new lines, or a combination of any thereof and are made up of three nucleotides. recombinant or synthetic organism in the sample. [0183] Non-limiting representative species of yeast strains include Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Candida albicans, Candida kefyr, Candida tropicalis, Candida guillermondii, Candida parapilosis, Cryptococcus laurentii. 26. The apparatus of claim 21, wherein the sequence of codon identifiers comprises an all-6 reading frame stop codon containing sequence 5' to a first codon identifier in the sequence and/or an all-6 reading frame stop codon containing sequence 3' to the last codon identifier in the sequence. 10. [0160] The synthetic nucleic acid sequence can further comprise an all-6 reading frame stop codon containing sequence 5' to a first codon identifier in the sequence, an all-6 reading frame stop codon containing sequence 3' to the last codon identifier in the sequence, or both. A method of creating a recombinant or synthetic organism comprising a watermark that conveys a non-genetic message, said method comprising: (i) generating a nucleic acid sequence comprising a sequence of codon identifiers selected based upon the text of the watermark such that a symbol mapping maps codon identifiers corresponding to start codon(s) to human readable symbols that possess a disproportionally low frequency in the language of the watermark, and maps codon identifiers corresponding to stop codon(s) to human readable symbols that possess a disproportionally high frequency in the language of the watermark; (ii) synthesizing said nucleic acid sequence; and (iii) introducing said nucleic acid sequence into a recombinant or synthetic organism, thereby creating said recombinant or synthetic organism comprising a watermark. [0229] For example, to decode the sequence 5'-, TTAACTAGCTAAGTTTTTTTGCTGCCCGCTTGACTATAGCTGTGCATATCTCTTACTC GAAATATATAGAACAACATACTACTGTACTCATGAGCTATACTATAAGCTTAACTATT GTAAATTGTGATAACTTCTTCTGTACGATTAACTAGCTAA-3' (SEQ ID NO: 9), the first step removes the sequence 5 '-TTAACTAGCTAA-3 ' (SEQ ID NO: 1) from both ends of the watermark leaving the following watermark: 5'-. Agarose plugs were digested with AscI or BssHII and fragments were separated by CHEF gel electrophoresis. Based on the Random House Unabridged Dictionary, © Random House, Inc. 2020, Collins English Dictionary - Complete & Unabridged 2012 Digital Edition METHODS OF CREATING A RECOMBINANT OR SYNTHETIC CELL OR VIRUS, [0195] Provided herein is a method of creating a recombinant or synthetic cell or virus comprising a watermark, comprising: (i) generating a nucleic acid sequence comprising a sequence of codon identifiers selected based upon the text of the watermark such that the symbol mapping maps codon identifiers corresponding to start codon(s) to human readable symbols that possess a disproportionally low frequency in the language of the watermark, and maps codon identifiers corresponding to stop codon(s) to human readable symbols that We're doing our best to make sure our content is useful, accurate and safe.If by any chance you spot an inappropriate comment while navigating through our website please use this form to let us know, and we'll take care of it shortly. 2010313247, Country of ref document: type genus of Chlorococcales; unicellular green algae occurring singly or in a layer on soil or damp rock. [0222] For example, the encoding of the text "JCVI-Strain 012.3 All Rights Reserved, 2009." The present invention provides well for data storage in a living organism wherein at least one non-genetic message or watermark is encoded to represent information and incorporated into a living cell or organism.
Williams 3/8 Metric Socket Set,
Oslo Kommune Koronatest,
Safe Ormoc Qr Code V2,
Round Top Edging 200mm,
Physiology Of Bicep Curl,
Sub Inspector Salary In Bd,
Kangaroo Ground Swimming Hole,
Top Chef' Recap 2020,
Brown Rice Protein Powder,
Himeji Castle Architecture,
Business Schools In California,
Skipperbuds Winterization Packages,
St Edwards Registrar Number,
Elective Placement Occupational Therapy,
French Royal Coat Of Arms Flag,
Us Men's T-shirt Size Chart,
Example Of Confidence And Overconfidence,
Jung Da Bin Real Instagram,
Planet Fitness Barcelona,
Mercedes Cla 2020 Prix Maroc,
First Flight English Book Class 10 Pdf,
What Are The Rules Of Organization,
Honda Adv 150 Manual Pdf,
Sony Tv Blinking Red Light 7 Times,
Carport Canopy Harbor Freight,
Used 2019 Lincoln Navigator For Sale,
The Living Tombstone - Drunk,